Mồi và mẫu dò theo khuyến cáo của WHO cho 2019-nCoV/SARS-CoV-2

0

Mồi và mẫu dò theo khuyến cáo của WHO cho 2019-nCoV/SARS-CoV-2 ( primers và probes)

  1. Primers và probes theo chuẩn WHO
  2. Genewizt
  3. Bao gồm 6 primers và 3 mẫu dò RdRP_SARSr-F2 RdRP_SARSr-R1 RdRP_SARSr-P2Primer RdRP_SARSr-F2 Primer RdRP_SARSr-R1 Probe RdRP_SARSr-P1E_Sarbeco_F1 E_Sarbeco_R2 E_Sarbeco_P1
SKU: 12TBR Categories: , Tags: , ,

Description

Hits: 173

Mồi và mẫu dò theo khuyến cáo của WHO cho 2019-nCoV/SARS-CoV-2 ( primers và probes)

Trên Thế giới, các nhà nghiên cứu đang làm việc không mệt mỏi để mô tả và hiểu các cơ chế của coronavirus mới (2019-nCoV / SARS-CoV-2). Sự hợp tác toàn cầu chưa từng có của các nhà khoa học và các tổ chức đã dẫn đến sự giải trình tự bộ gen virut, cuối cùng dẫn đến sự phát triển các xét nghiệm dựa trên phản ứng chuỗi polymerase để xác định nhanh virus ở người nhiễm bệnh

GENEWIZ vẫn cam kết thúc đẩy nghiên cứu xung quanh ổ dịch với các giải pháp độc đáo của chúng tôi. Các nhà khoa học hiện có thể đặt hàng mồi và thăm dò được phê duyệt bởi Trung tâm Kiểm soát và Phòng ngừa dịch bệnh (CDC), Tổ chức Y tế Thế giới (WHO) và chính phủ Trung Quốc để xác định nhanh chóng virus.

Nguồn Primer ID Mô tả Sequence (5′ – 3′) 5′ Modification 3′ Modification
US CDC 2019-nCoV_N1-F 2019-nCoV_N1 Forward Primer GACCCCAAAATCAGCGAAAT    
2019-nCoV_N1-R 2019-nCoV_N1 Reverse Primer TCTGGTTACTGCCAGTTGAATCTG    
2019-nCoV_N1-P 2019-nCoV_N1 Probe ACCCCGCATTACGTTTGGTGGACC 5′-FAM 3′-BHQ1
 
2019-nCoV_N2-F 2019-nCoV_N2 Forward Primer TTACAAACATTGGCCGCAAA    
2019-nCoV_N2-R 2019-nCoV_N2 Reverse Primer GCGCGACATTCCGAAGAA    
2019-nCoV_N2-P 2019-nCoV_N2 Probe ACAATTTGCCCCCAGCGCTTCAG 5′-FAM 3′-BHQ1
 
2019-nCoV_N3-F 2019-nCoV_N3 Forward Primer GGGAGCCTTGAATACACCAAAA    
2019-nCoV_N3-R 2019-nCoV_N3 Reverse Primer TGTAGCACGATTGCAGCATTG    
2019-nCoV_N3-P 2019-nCoV_N3 Probe AYCACATTGGCACCCGCAATCCTG 5′-FAM 3′-BHQ1
 
RP-F RNAse P Forward Primer AGATTTGGACCTGCGAGCG    
RP-R RNAse P Reverse Primer GAGCGGCTGTCTCCACAAGT    
RP-P RNAse P Probe TTCTGACCTGAAGGCTCTGCGCG 5′-FAM 3′-BHQ1
 
WHO RdRP_SARSr-F2 RdRP gene GTGARATGGTCATGTGTGGCGG    
RdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATA    
RdRP_SARSr-P2 CAGGTGGAACCTCATCAGGAGATGC 5′-FAM 3′-BHQ1
   
Primer RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGG    
Primer RdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATA    
Probe RdRP_SARSr-P1 CCAGGTGGWACRTCATCMGGTGATGC 5′-FAM 3′-BHQ1
 
E_Sarbeco_F1 E gene ACAGGTACGTTAATAGTTAATAGCGT    
E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA    
E_Sarbeco_P1 ACACTAGCCATCCTTACTGCGCTTCG 5′-FAM 3′-BHQ1
 
 CDC Trung Quốc 2019-nCoV-OFP   CCCTGTGGGTTTTACACTTAA    
2019-nCoV-ORP ORF1ab ACGATTGTGCATCAGCTGA    
2019-nCoV-OP   CCGTCTGCGGTATGTGGAAAGGTTATGG 5′-FAM 3′-BHQ1
 
2019-nCoV-NFP   GGGGAACTTCTCCTGCTAGAAT    
2019-nCoV-NRP Nucleoprotein-protein N CAGACATTTTGCTCTCAAGCTG    
2019-nCoV-NP   TTGCTGCTGCTTGACAGATT    

Để hiểu rõ hơn về bản chất của xét nghiệm. Mời bạn đọc thêm về nguyên lý xét nghiệm SARS-CoV-2

Tham khảo thêm

 

Bình luận Facebook

Reviews

There are no reviews yet.

Be the first to review “Mồi và mẫu dò theo khuyến cáo của WHO cho 2019-nCoV/SARS-CoV-2”

Your email address will not be published. Required fields are marked *