Nhận dạng 2019-nCoV/SARS-CoV-2 với mồi và mẫu dò theo CDC US


Nhận dạng 2019-nCoV/SARS-CoV-2 với mồi và mẫu dò theo CDC US

  1. Primers và probes theo chuẩn CDC US
  2. Hãng Genewiz
  3. Bao gồm 08 primer và 04 mẫu dò:


Hits: 34

Nhận dạng 2019-nCoV/SARS-CoV-2 với mồi và mẫu dò theo CDC US

Trên Thế giới, các nhà khoa học đang làm việc không mệt mỏi để mô tả và hiểu các cơ chế của coronavirus mới (2019-nCoV / SARS-CoV-2).

Sự hợp tác toàn cầu chưa từng có của các nhà khoa học và các tổ chức đã dẫn đến sự giải trình tự bộ gen virut, cuối cùng dẫn đến sự phát triển các xét nghiệm dựa trên phản ứng chuỗi polymerase để xác định nhanh virus ở người nhiễm bệnh

GENEWIZ vẫn cam kết thúc đẩy nghiên cứu xung quanh ổ dịch với các giải pháp độc đáo của chúng tôi. Các nhà khoa học hiện có thể đặt hàng mồi và thăm dò được phê duyệt bởi Trung tâm Kiểm soát và Phòng ngừa dịch bệnh (CDC), Tổ chức Y tế Thế giới (WHO) và chính phủ Trung Quốc để xác định nhanh chóng virus.

Nguồn Primer ID Mô tả Sequence (5′ – 3′) 5′ Modification 3′ Modification
US CDC 2019-nCoV_N1-F 2019-nCoV_N1 Forward Primer GACCCCAAAATCAGCGAAAT    
2019-nCoV_N1-R 2019-nCoV_N1 Reverse Primer TCTGGTTACTGCCAGTTGAATCTG    
2019-nCoV_N2-F 2019-nCoV_N2 Forward Primer TTACAAACATTGGCCGCAAA    
2019-nCoV_N2-R 2019-nCoV_N2 Reverse Primer GCGCGACATTCCGAAGAA    
2019-nCoV_N3-F 2019-nCoV_N3 Forward Primer GGGAGCCTTGAATACACCAAAA    
2019-nCoV_N3-R 2019-nCoV_N3 Reverse Primer TGTAGCACGATTGCAGCATTG    
2019-nCoV-NRP Nucleoprotein-protein N CAGACATTTTGCTCTCAAGCTG    

Để hiểu rõ hơn về bản chất của xét nghiệm. Mời bạn đọc thêm về nguyên lý xét nghiệm SARS-CoV-2

Tham khảo thêm

Bình luận Facebook


There are no reviews yet.

Be the first to review “Nhận dạng 2019-nCoV/SARS-CoV-2 với mồi và mẫu dò theo CDC US”

Your email address will not be published. Required fields are marked *